DNA nanotechnology in molecular design of thrombin aptamers

The field of DNA nanotechnology has had a remarkable impact on nanobiotechnology, and has been developed rapidly. New manipulatable nanoscaled structures or machines constructed by DNA molecules are widely used in biomedical field. An interesting goal of DNA nanotechnology is to assemble DNA nanostructures to display multivalent interactions, which are characterized by simultaneous binding of multiple ligands on one biological entity to multiple receptors on another. With well-established DNA modification methods, multivalent aptamers targeting binding entities have been developed. Thrombin is a coagulation protein that plays a rather vital role in the coagulation cascade-converting soluble fibrinogen into insoluble strands of fibrin. Therefore, thrombin is usually considered an important target when searching for anti-coagulants and antithrombotics to interfere with blood coagulation. Among thrombin inhibitors, aptamers have shown great advantages. Aptamers are short DNA or RNA strands that can specifically bind to proteins and inhibit their activities. They can be selected using a technique known as SELEX (systematic evolution of ligands by exponential enrichment). Aptamers specifically recognize and bind to various target molecules (ions, small organic, inorganic molecules, proteins or living cells) with dissociation constants (K-d) in the picomolar to nanomolar range by folding into unique secondary or tertiary structures that accommodate the target's molecular structure. Two thrombin aptamers bind to two different sites of thrombin. The 15-mer thrombin-binding aptamer (TBA15: GGTTGGTGTGGTTGG) having a G-quadruplex structure in the presence of potassium ions can recognize the fibrinogen-binding exosite of thrombin via a T-loop and inhibit the thrombin activity but the binding affinity is modest (K-d, similar to 100 nmol/L). The 29-mer thrombin-binding aptamer (TBA29: AGTCCGTGGTAGGGCAGGTTGGGGTGACT) recognizes the heparin-binding exosite of thrombin and exhibits weak inhibitory capability toward thrombin, but has strong binding affinity (K-d, similar to 0.5 nmol/L). Traditionally, the molecular design of thrombin aptamers focuses on the structural modification of TBA15, and in some designs, the activity of thrombin can be recovered by introduction of complementary strand of aptamers or some small molecules. Therefore, many reversible inhibitors have been constructed based on aptamer TBA15. However, the application of monovalent aptamers-based technology is limited due to the low affinity of monomers. With the quest to develop new antithrombotic agents stimulated by clinical needs and advances in biotechnology, multivalent aptamers with independent stable structures are developed to improve the binding capabilities. In multivalent interactions, when one of the monomers dissociates from the target, another monomer, which can also bind to the same target, can increase its opportunity of binding to the target again. Present molecular designs of thrombin aptamer are mainly based on the structural modifications of the divalent aptamers. With the development of DNA nanotechnology, the precise control of thrombin activity can be achieved by constructing new DNA nanostructures, which can effectively improve the functionality of the bivalent aptamers. It can be predicted that the studies on anticoagulants will gradually expand from structural design to practical applications. In this review, monovalent and divalent thrombin aptamers are discussed, and finally, a perspective on the future directions of this field is presented. We hope this review may help researchers to improve techniques to develop ideal anticoagulants, with potential benefits including high efficacy, safety, rapid onset of action and no requirement for therapeutic monitoring.