Characteristics of Clostridium difficile strains isolated from asymptomatic individuals and from diarrheal patients

Objectives To characterise genotypes of Clostridium difficile strains isolated from asymptomatic individuals and patients with diarrhea. Methods Fecal specimens from 235 asymptomatic infants <12months, 76 asymptomatic children 1-11 years and 132 adult patients with antibiotic-associated and non-antibiotic-associated diarrhea obtained from Siriraj Hospital, Bangkok from October 1998 to April 1999 were examined for C difficile by cycloserine-cefoxitin-fructose agar culture. The presence of the C. difficile toxin A gene was determined by specific PCP with the use of primers 5-(CCCAATAGAAGATTCAATATTAAGCTT)-3 and 5-(GGAAGAAAAGAACTTCTGGCTCACTCAGGT)-3. All C. difficile isolates were subsequently genotyped by pulsed-field gel electrophoresis (PFGE). Results The C. difficile strains were found in 28 (11.9%) asymptomatic infants, 16 (21.1%) asymptomatic children and 33 (25%) adult patients. In total, 14 PFGE types and eight subtypes designated as types A, B, C, D, E, F, G, H, I, J, K, L, M and N, and A1, A2, A3, A4, B1, B2, B3 and E1, respectively, were identified. Only two isolates from infants and 18 isolates from adult patients were toxin A gene positive by PCP,. Both isolates of toxigenic C. difficile were from infants in the same ward and were PFGE type B. PFGE type A was the predominant type among all toxigenic isolates (12 of 18 isolates) from adult patients. The other PFGE types of toxigenic C. difficile found in adult patients were: type A1, one isolate; type B, four isolates; and type C, one isolate. Types B2 and D were identified in 38.5% and 46.2%, respectively, of the toxin A gene-negative isolates of C. difficile a from infants. Conclusions These results revealed the occurrence of three distinct clusters from different wards in Siriraj Hospital. The toxigenic C. difficile of PFGE type A and related subtypes was a predominant infective clone in adult patients, whereas non-toxigenic C. dale types B2 and D were encountered in asymptomatic infants. This information can be useful in epidemiologic investigations.