A descriptive study of NPHS1 and NPHS2 mutations in children with congenital nephrotic syndrome

Introduction: Congenital nephrotic syndrome (CNS) is a rare disorder characterized by proteinuria, hypoalbuminemia, edema and hyperlipidemia at birth or within the first 90 days of life. NPHS1 and NPHS2 gene mutations encoding the slit diaphragm components: nephrin and podocin account for 78% of CNS cases. Methods: Our study was carried out to assess NPHS1 and NPHS2 gene mutations in 16 CNS Egyptian patients descending from 16 different families. Demographic, clinical, laboratory and pathological data of included patients were collected. The whole coding region of NPHS2 and nine exons of NPHS1 were sequenced. Results: The study showed a homozygous nonsense mutation c.3478C > T (p.R1160X) within exon 27 of NPHS1 gene in two patients. By comparing clinic-laboratory data of these two patients with other included CNS patients; a significant association between c.3478C > T (p.R1160X) and low free T3 serum level was noted. Patients with c.3478C > T (p.R1160X) had more proteinuria than others but did not reach the level of significance (p =.073). Moreover, five NPHS2 mutations were detected in five different patients; two homozygous mutations [23 bp duplication c.104-126 dup GCCGCGGGCGCCAGGAGGCTGG (p. P43Afs*64), and c.59C > T (p.P20L)], and three novel heterozygous missense mutations: c.345 G > A (M115I), c.346A > T (p.T116S), and c.732 T > A (p.D244E). Conclusion: NPHS1 and NPHS2 gene mutations were found in 43.75% of Egyptian CNS children. NPHS2 contributed for 31% of the studied Egyptian CNS cohort. A phenotype-genotype correlation was noticed regarding c.3478C > T (p.R1160X) mutation in NPHS1 gene as it was significantly associated with decreased serum free T3 and increased levels of proteinuria compared to other CNS patients.