Epidermal growth factor induces CD44 gene expression through a novel regulatory element in mouse fibroblasts

Growth factors coordinately regulate a variety of genes associated with pathological states including tumor invasion and metastasis, Overexpressed epidermal growth factor receptor (EGFR) on tumor cell surfaces is associated with enhanced cell attachment and migration into extracellular matrices, which promotes tumor aggressiveness, We have demonstrated that epidermal growth factor (EGF) up-regulates the cell surface adhesion molecule CD44 at both the mRNA and protein levels on mouse fibroblasts expressing full-length wild-type EGFR (NR6-WT) but not on EGFR-deficient cells (NR6-P). This increases cell attachment to hyaluronic acid. In this investigation, transcriptional regulation of CD44 by EGF was confirmed by defining an EGF-regulatory element, By employing human CD44 gene promoter-chloramphenicol acetyltransferase (CAT) constructs transfected into NR6-WT cells, EGF inducibility was observed within a 120-base pair (bp) DNA fragment located 450 bp upstream of the RNA initiation site. Differential EGF inducibility was found among different cell lines chosen, indicating a 3.2- and 1.8-fold enhancement in DU145 cells carrying exogenous wild-type EGFR and in MCF-7 cells, respectively, while minimal EGF induction was found in cervical cancer HeLa cells. Utilizing gel shift assays, a time-dependent increase of DNA-protein complex formation was found upon EGF stimulation in NR6-WT cells but not in NR6-P cells, Based upon these observations, a novel 22-bp EGF regulatory element (ERE) (5'-(-604)CCCTCTCTCCAGCTCCTCTCCC(-583)-3') was isolated from the CD44 gene promoter. This ERE conferred DNA-protein binding ability in vitro, as well as the full functional recovery of EGF inducibility of CAT activity when linked to a homologous CD44 promoter or a SV40 promoter driving a CAT reporter gene. A two-base mutation of the ERE completely eliminated its binding activity as well as its EGF inducibility of CAT expression, Our studies indicate that EGF induces CD44 gene expression through an interaction between a specific ERE and putative novel transcriptional factor so as to regulate cell attachment to extracellular matrix.